HS-LS4-1: Communicating the Evidence for Common Ancestry and Evolution
In plain English: HS-LS4-1 is the NGSS high school performance expectation that asks students to communicate how several independent lines of evidence, including DNA sequences, anatomical structures, embryo development and fossils, support common ancestry and biological evolution. Students compare data, explain what each line shows and present it clearly. It is usually taught in Biology.
Communicate scientific information that common ancestry and biological evolution are supported by multiple lines of empirical evidence.
Clarification Statement: Emphasis is on a conceptual understanding of the role each line of evidence has relating to common ancestry and biological evolution. Examples of evidence could include similarities in DNA sequences, anatomical structures, and order of appearance of structures in embryological development.
Next Generation Science Standards · Disciplinary Core Idea: Biological Evolution: Unity and Diversity · Official standard
Students gather, compare and communicate the evidence that living species share common ancestors and that populations have changed over long spans of time. They count differences between DNA sequences and turn them into percent similarity, compare the bones inside forelimbs that do very different jobs, put the structures that appear in vertebrate embryos in order, and read the order of fossils in rock layers. The goal is not a list of facts but an explanation of the role each line of evidence plays, and why it matters that lines gathered by different methods point to the same branching pattern.
The NGSS Clarification Statement says: "Emphasis is on a conceptual understanding of the role each line of evidence has relating to common ancestry and biological evolution. Examples of evidence could include similarities in DNA sequences, anatomical structures, and order of appearance of structures in embryological development." HS-LS4-1 has no official Assessment Boundary. The DNA sequences on this page are short, invented segments written for teaching and labeled as invented; the anatomical, embryo and fossil facts are real and rounded. Students do the practice of obtaining, evaluating and communicating information: every activity ends with a claim they present to an audience.
Learning Objectives
By the end of this lesson, students will be able to:
Count the differences between two aligned DNA sequences, express their similarity as a percent, and use a table of differences to decide which species share the most recent common ancestor
Distinguish homologous structures from analogous structures and explain why only homologous structures (including vestigial ones) are evidence of common ancestry
Explain how the shared order in which structures appear in vertebrate embryos supports common ancestry
Use the order of fossils in rock layers to describe how a group of organisms changed over time
Communicate, in writing and aloud, how several independent lines of evidence together support common ancestry and biological evolution
Prior Knowledge Required
Students should already be comfortable with:
Patterns in the fossil record and the relative age of rock layers MS-LS4-1
Anatomical similarities among modern and fossil organisms MS-LS4-2
Comparing embryos of different species MS-LS4-3
DNA as a sequence of four bases (A, C, G, T) that carries genetic information
Project outline drawings of the forelimb skeletons of a human, a cat, a whale and a bat, with every bone the same neutral color. Give pairs one minute to look before any discussion.
Warm-Up Prompt
"These four limbs grasp, walk, swim and fly. List every way the skeletons are alike. If an engineer designed each limb from scratch for its job, would you expect them to be this alike? What else could explain the pattern?"
Collect the lists on the board. Students usually notice one upper bone, two lower bones, a wrist and five sets of finger bones. Keep the question "what else could explain it?" posted: the lesson tests one explanation, common ancestry, against several kinds of data.
Direct Instruction15-20 minutes
What the claim says.Common ancestry means that two or more species descend from the same ancestral population. Biological evolution is change in the heritable traits of populations over many generations. If both are true, species should fall into groups nested inside larger groups, like branches of a tree, and every kind of evidence should show the same branching pattern. Each line of evidence is gathered with different tools (sequencing machines, dissection, microscopes, rock dating), so agreement among them is hard to explain any other way. Work through the five examples below, and name the role of each line before moving on.
DNA sequences: counting differences
Aligned 20-base segments of one gene (invented for teaching). Species P: ATGGCTTACGGAACTTTGCA. Species Q: ATGGCATACGGTACTTTGCG.
Result: Compare base by base: the sequences differ at positions 6, 12 and 20, so there are 3 differences. Similarity = 17 ÷ 20 = 85%. The more bases two species share, the more recently they are likely to share an ancestor.
DNA and protein data: a table of differences
Amino-acid differences in one invented 100-amino-acid protein: J-K 2, J-L 9, K-L 9, J-M 15, K-M 15, L-M 14.
Result: J and K differ least (98% identical), so they share the most recent common ancestor. L joins them next (9 differences from both), and M branches off earliest. The tree is ((J, K), L), M.
Anatomical structures: homology
The forelimbs of a human, a cat, a whale and a bat grasp, walk, swim and fly. A bird wing and a butterfly wing both fly.
Result: The four mammal limbs all contain one upper arm bone (humerus), two forearm bones (radius and ulna), wrist bones and finger bones: the same structure inherited from a common ancestor and put to different uses (homologous). The bird and butterfly wings share a function but are built from different materials in different ways (analogous), so they are not evidence of a close common ancestor.
Embryological development: order of appearance
Early embryos of a fish, a chicken and a human are compared stage by stage.
Result: In all three, a notochord forms first, then a series of pharyngeal arches in the neck region, then limb buds (fin buds in the fish). The same structures appearing in the same order points to a developmental program inherited from a shared ancestor. Later the arches take different paths: in fish they support gills, and in mammals they help form parts of the jaw, the middle ear and the throat.
Fossils and several lines together: whales
Fossils from about 50 to 40 million years ago (Diagram 2), the ankle bones of early whales, DNA of living mammals, and modern whale skeletons.
Result: Fossils show a series from land-living mammals with whale-like ear bones to fully aquatic forms with tiny hind limbs. Early whale fossils have the double-pulley ankle bone found in even-toed hoofed mammals, DNA places hippos as the closest living relatives of whales, and modern whales still have small pelvic bones. Four independent lines give the same answer.
After each example ask: "What would we expect to see if these species did NOT share an ancestor?" Point out that fewer DNA differences means a more recent common ancestor only if the sequences change at similar rates, which is why scientists compare many genes. Stress that no living species is the ancestor of another living species: humans and chimpanzees, or whales and hippos, are cousins that share an ancestor.
Guided Practice15 minutes
Pairs use the trait table below to build a branching diagram, then compare it with Diagram 1. A 1 means the adult or embryo has the trait.
Guided practice: shared traits of five chordates
Animal
Notochord
Backbone
Four limbs
Amniotic egg
Hair and milk
Lancelet
1
0
0
0
0
Perch
1
1
0
0
0
Frog
1
1
1
0
0
Lizard
1
1
1
1
0
Mouse
1
1
1
1
1
Count the traits each animal has. Which trait is shared by all five, and which by only one?
The traits are nested: every animal with four limbs also has a backbone, and every animal with an amniotic egg also has four limbs. Explain why common ancestry predicts this nesting.
Draw the branching diagram, placing each trait where it first appears. Check it against Diagram 1.
Write one sentence that states which two animals share the most traits and what that suggests about their ancestry.
Independent Practice10-15 minutes
Each student writes a museum placard of 100-150 words for a general audience about the blind cavefish of Mexico, using the evidence card below. The placard must name at least two lines of evidence and say what each one shows.
Evidence card: blind cavefish (DNA counts invented for practice; the other facts are real)
Line of evidence
Observation
DNA
In an invented 500-base segment, a cave population differs from nearby river fish of the same species at 3 bases, and from a different river species at 40 bases
Embryos
Cavefish embryos begin to form eyes, which then stop growing and break down
Anatomy
Adults have small eye remnants covered by skin
Students compute the similarities (99.4% and 92%) and use them with the embryo and anatomy observations to argue that cavefish descend from sighted river fish. Ask: "Which line of evidence would convince a reader who does not trust numbers?"
Closure5 minutes
Exit ticket: "Name two lines of evidence for common ancestry. For each, write one sentence about what scientists observe and why it supports the idea." Then return to the warm-up question and ask a few students to answer it again, now using the word homologous.
Differentiation Strategies
For Struggling Students
Give sequence strips printed in large type with a numbered ruler above each base, and have students circle each mismatch before counting
Provide a sentence frame for the placard: "Scientists compared ___. They found ___. This supports common ancestry because ___."
Color-code the forelimb bones (humerus one color, radius and ulna another) so the shared pattern is easy to see before discussing it
For Advanced Students
Ask students to explain why a tree built from one short gene might disagree with the tree built from anatomy, and how comparing many genes resolves this
Have students research one more line of evidence, such as the geographic distribution of related species, and add it to the whale case
Ask students to predict what a DNA comparison of whales, hippos and cows should show if the fossil ankle-bone evidence is right, then look up whether published studies agree
Assessment Guidance
What to Look For
Check that students name what each line of evidence shows, not only that it exists: DNA similarity shows how closely related species are, homologous structures show a shared body plan inherited from an ancestor, embryo order shows shared development, and fossils show change over time. Watch for students who treat analogous structures as evidence of close ancestry, who say one living species turned into another, or who count DNA differences without converting them to a comparison. Strong answers explain why independent lines agreeing matters.
02
Classroom Activities
3 Activities
1
DNA Sequence Comparison Lab
25 minPairs
Pairs receive printed strips with the same invented 24-base segment of one gene from five species, V to Z. They count the differences between every pair, fill in a table of differences, and build a branching tree from it.
Sequence Strips (invented for teaching)
Species V:GATGCCTTCTGAGCGTGCCCCGGC
Species W:GATGCCTTCTGAGCTAGCCCCGGC
Species X:CATGCCTTCTTTGCGAGCCCCGCC
Species Y:CATGCACTCTGTGCGAGTCCCCGG
Species Z:CATGCCCCCTGTGCGAGCCCCCGG
Procedure
Lay two strips side by side and mark each position where the bases differ. Record the count in a 5-by-5 table. There are 10 pairs.
Find the pair with the fewest differences and join them on a tree. Then find the next closest species or pair, and continue until all five are joined.
Convert each count to a percent similarity (24 - differences, divided by 24).
Answer key for the teacher: V-W 2, V-X 5, W-X 5, Y-Z 3; every other pair differs at 6-8 bases.
Discussion Questions
V and W differ at only 2 bases, the smallest count in the table. What does that suggest about their ancestry?
Species X differs from both V and W at 5 bases, but from Y and Z at 6 or 7. Where does X belong on your tree, and why?
Your tree has two main branches. Which line of evidence would you check next to test whether those branches are real?
Modification for Distance Learning
Share the five sequences in a spreadsheet with one base per cell. Students use a formula that marks mismatched cells, count them, and post their tree to the class board.
2
Anatomy and Embryo Stations
25 minGroups of 3-4
Groups rotate through four stations every 6 minutes. At each station they record an observation, classify it, and write one sentence about what it shows about ancestry.
Stations
Station 1, forelimbs: outline drawings of a human arm, a horse foreleg, a sea lion flipper and a bat wing. Students color the humerus, radius, ulna, wrist and finger bones and compare the counts.
Station 2, homologous or analogous: six picture cards (bat wing, housefly wing, whale flipper, penguin flipper, human arm, bird wing). Students sort pairs and justify each choice.
Station 3, vestigial structures: cards on the small pelvic bones of whales, the tailbone (coccyx) of humans, and the skin-covered eye remnants of cave salamanders. Students explain what ancestors with these structures would have used them for.
Station 4, embryo order: shuffled cards showing a notochord, pharyngeal arches and limb buds for a fish, a chicken and a human. Students put each species in order of appearance and compare.
Discussion Questions
At Station 2, which pair shares a function but not a structure? Why is that pair weak evidence for a close common ancestor?
At Station 4, did all three species show the same order of appearance? What would a different order in one species have suggested?
Which station gave the strongest evidence, in your view, and why?
Challenge Variation
Give groups a card for a structure they have not seen (the tiny hind-limb bones inside some pythons) and ask them to decide which station it belongs to and what it suggests about the ancestors of snakes.
3
Evidence Briefing: Communicating Common Ancestry
30 minGroups of 3
Each group prepares a 3-minute briefing or a one-page infographic on one case, for an audience of ninth graders who have not studied evolution. The audience scores each briefing with a checklist.
Case Files (real evidence, rounded)
Birds and dinosaurs: Archaeopteryx, about 150 million years old, had feathers, teeth, clawed fingers and a long bony tail; many theropod dinosaurs had a wishbone and hollow bones; DNA places crocodilians as the closest living relatives of birds.
Humans and other apes: human and chimpanzee DNA sequences are about 98-99% identical where they can be aligned; human chromosome 2 carries signs of two ancestral chromosomes joined end to end, which are still separate in chimpanzees and gorillas; all apes share the same arm and hand bones.
Snakes and lizards: pythons and boas keep small pelvic bones and claw-like spurs; fossil snakes with small hind legs are known from rocks roughly 90-100 million years old; python embryos begin to form hind-limb buds that stop growing.
Briefing Requirements
Name at least three lines of evidence and say what each one shows.
Include one number (an age, a percent or a count) and explain what it means.
Correct one likely misunderstanding, for example that humans evolved from chimpanzees.
End with a one-sentence claim the audience could repeat.
Audience Checklist
Did the group explain each line of evidence, not only name it?
Did every piece of evidence connect to the claim?
Could you explain the claim to someone outside class?
Modification for Distance Learning
Groups record a short narrated slide show and post it; classmates leave checklist comments on two briefings.
03
Diagrams & Visual Aids
2 diagrams
Diagram 1: Branching Diagram from Shared Anatomical Traits
The five chordates from the guided practice table. Each trait appears once, where it first arose, and is shared by every animal that branches off after it. The nested pattern (all four-limbed animals have a backbone, all animals with an amniotic egg have four limbs) is what common ancestry predicts. DNA comparisons of these groups give the same branching order.
Diagram 2: Fossils Along the Path to Modern Whales
Approximate ages of four fossil whales, drawn to scale from 55 to 35 million years ago, with an axis break before today. The fossils are placed in order of age; they show how the group changed over time and are not claimed to be direct ancestors of one another. Hind limbs shrink across the series, and modern whales keep only small pelvic bones.
04
Homework Assignment
~30 min
HS-LS4-1 Homework: Weighing the Evidence for Common Ancestry
Directions: DNA sequences and tables in Problems 1-2 are invented for practice. The anatomical, embryo and fossil facts are real and rounded. Show every count or percent, and end each problem with a sentence that states what the evidence shows.
Part 1: DNA Evidence (Problems 1-2)
Aligned 30-base segments of one gene from two invented beetle species are shown. Species 1: GCTAAAGACAATTACATAACATACACGTCA. Species 2: GCTTAAGACAACTACATAATATACACTTCA. (a) How many bases differ? (b) What percent of the bases are the same, to the nearest tenth of a percent? (c) Name one other line of evidence you would check before concluding that the two species are close relatives, and say what you would expect to find.
Four invented tree frog species were compared in one 50-base DNA segment. The numbers of differences are R-S 11, R-T 4, R-U 11, S-T 11, S-U 6, T-U 11. (a) Which two pairs are most closely related? (b) Sketch the tree. (c) Write two sentences for a classmate explaining how the table supports common ancestry.
Part 2: Anatomy and Embryos (Problems 3-4)
Classify each pair as homologous or analogous and give a reason: (a) a penguin flipper and a human arm, (b) a dragonfly wing and a bat wing, (c) a mole's digging forelimb and a sea lion's front flipper, (d) a dolphin flipper and a penguin flipper. For (d), explain why the answer depends on whether you mean the bones inside or the flattened shape.
A classmate says: "Human embryos have gills, so humans used to be fish." (a) What structures are actually present in the neck region of an early human embryo, and what do they become? (b) Rewrite the claim so that it is accurate. (c) Predict the order in which a notochord, pharyngeal arches and limb buds (fin buds) appear in the embryos of a shark, a turtle and a mouse, and explain why a shared order would be evidence of common ancestry.
Part 3: Fossils and Communication (Problems 5-6)
Three real Devonian fossils: Eusthenopteron, about 385 million years old, a fish whose fin bones include one upper bone and two lower bones; Tiktaalik, about 375 million years old, a fish with a neck, a flat head and wrist-like fin bones; Acanthostega, about 365 million years old, with legs ending in eight digits and with gills. (a) Order them from oldest to youngest and give the time between each pair. (b) Describe the change in the limb over the series. (c) Explain why the order of these fossils in the rock record supports biological evolution.
Write a 150-200 word letter to the editor responding to the claim "Evolution is just a guess because nobody saw it happen." Use at least three lines of evidence from this unit, say what each shows, and explain why agreement among independent lines is strong support.
Rubric
Criterion
Full Credit (2 pts)
Partial Credit (1 pt)
Using the Data
Counts, percents and orders are correct and shown
Method correct with one counting or arithmetic error
Role of Each Line of Evidence
States what each line shows about ancestry or change over time
Names the evidence but does not explain its role
Accuracy of Claims
Uses homologous and analogous correctly and avoids "one living species became another"
One misconception or misused term
Communication
Clear, organized writing for the stated audience, with a claim supported by specific evidence
Claim is present but the evidence is vague or disorganized
05
Quiz: 20 Questions
Interactive, with answers
Instructions
DNA sequences and tables marked invented were written for practice; anatomical, embryo and fossil facts are real and rounded. Your score updates as you answer, and Reset quiz clears everything so you or your students can try again.
Multiple choice: pick an option to check it. Short answer: write your answer, then reveal the model answer.
0 of 20 answered · 0 correct
Question 1 of 20 · Multiple Choice
Two species "share a common ancestor." What does that mean?
Answer: B
Common ancestry means both lineages trace back to one ancestral population and then split. Choice A describes one living species becoming another, a frequent misunderstanding: the two are cousins, not parent and child. Choices C and D describe shared environments, which can make unrelated species look alike.
Question 2 of 20 · Multiple Choice
Two aligned 12-base DNA segments are shown: CACGAAACTTGT and CACGTAACTCGT. How many bases differ?
Answer: D
Comparing base by base, the segments differ at position 5 (A and T) and position 10 (T and C), so there are 2 differences. Choice C is the number of matching bases, not the number of differences. Choices A and B come from skipping or double-counting a position.
Question 3 of 20 · Multiple Choice
Two species differ at 150 bases in an aligned 1,000-base DNA segment. What percent of the bases are identical?
Answer: C
Identical bases = 1,000 - 150 = 850, and 850 ÷ 1,000 = 85%. Choice A is the percent that differ. Choice B treats 150 as if it were 15 differences, and choice D divides the 150 differences by 100 instead of by the 1,000-base length.
Question 4 of 20 · Multiple Choice
An invented table gives the number of DNA differences between four species: F-G 21, F-H 4, F-K 19, G-H 20, G-K 7, H-K 18. Which two species most likely share the most recent common ancestor?
Answer: A
F and H differ at only 4 bases, the smallest count in the table, so they most likely split from each other most recently. G and K (choice B) are the next closest pair at 7. Choices C and D pick the largest counts, which point to the most distant relationships.
Question 5 of 20 · Multiple Choice
Which pair of structures is homologous?
Answer: B
The lizard's front leg and the bird's wing contain the same set of bones (humerus, radius, ulna, wrist and finger bones) inherited from a common four-limbed ancestor, even though one is used for walking and the other for flying. Choices A, C and D are analogous: the structures do similar jobs but are built in different ways by lineages that are not closely related.
Question 6 of 20 · Multiple Choice
A hummingbird and a hawk moth both hover in front of flowers on rapidly beating wings while they drink nectar. What does this similarity tell a biologist?
Answer: C
The wings are analogous: a hummingbird wing is a modified forelimb with bones and feathers, while a hawk moth wing is a thin sheet of chitin with no bones. Similar function arose separately. Choice A treats analogy as homology, choice B has one living group turning into another, and choice D is false because insects have no bones.
Question 7 of 20 · Multiple Choice
Kiwis cannot fly, yet each kiwi has a tiny wing, only a few centimeters long and hidden under its feathers, that contains a humerus, a radius and an ulna like the wing of a flying bird. What is the best explanation?
Answer: A
Vestigial structures like these tiny wings are reduced versions of structures that worked in ancestors, and DNA places kiwis among the birds. Choice B wrongly suggests evolution works toward a future goal. Choice C describes a change from disuse during one bird's life, which is not inherited. Choice D is false: adult kiwis cannot fly either.
Question 8 of 20 · Multiple Choice
Adult baleen whales, such as humpback whales, have no teeth: they filter food through baleen plates. Yet their embryos form tooth buds, which are reabsorbed before birth. Which conclusion do these data best support?
Answer: D
A structure that starts to form in the embryo and then disappears points to a developmental program inherited from ancestors that used it, and fossil baleen whales with teeth support this. Choice A is false: the buds are reabsorbed before birth. Choice B is an old idea that embryos replay adult ancestors: the embryo forms only tooth buds, not the body of an adult toothed whale. Choice C describes habitat, which does not explain the tooth buds.
Question 9 of 20 · Multiple Choice
Which observation from the fossil record is evidence of biological evolution?
Answer: B
An ordered sequence in which new body plans appear in younger layers shows that the kinds of organisms on Earth changed over time. Choice C describes how fossils form, and choice D describes size, neither of which shows change within a lineage.
Question 10 of 20 · Multiple Choice
Which statement describes biological evolution?
Answer: C
Evolution is a change in heritable traits of populations across generations. Choice A describes changes within one lifetime, which are not inherited. Choice B is false: many lineages, such as cave animals that lost their eyes, became simpler in some traits.
Question 11 of 20 · Multiple Choice
Why do scientists consider it strong evidence when DNA, anatomy, embryos and fossils all point to the same branching pattern?
Answer: A
Independent lines, collected with sequencing, dissection, microscopy and rock dating, could easily have disagreed; their agreement is what makes the conclusion strong. Choice B misunderstands science, which stays open to new evidence. Choice D ignores that anatomy and fossils are the only evidence for extinct groups whose DNA is gone.
Question 12 of 20 · Multiple Choice
If common ancestry is correct, how should a tree built from DNA differences compare with a tree built from shared anatomical traits for the same species?
Answer: D
One history of branching produced both the DNA differences and the anatomical traits, so the trees should largely match; they do, for groups such as the five chordates in Diagram 1. Choice B ignores this prediction, which is exactly what makes the comparison a test.
Question 13 of 20 · Multiple Choice
Species P is compared with three other species over a 200-base DNA segment. It differs from species R at 12 bases. What percent of the bases do P and R share?
Answer: B
Shared bases = 200 - 12 = 188, and 188 ÷ 200 = 94%. Choice A is the percent that differ. Choice C subtracts 12 from 100 without dividing by the 200-base length, and choice D treats the segment as 1,000 bases long.
Question 14 of 20 · Multiple Choice
Which sentence best communicates the evidence for common ancestry to a general audience?
Answer: A
Choice A names two independent lines (anatomy and DNA) and says what each shows. Choice B relies on analogous body shape. Choice C describes wanting a trait, but individuals cannot choose heritable traits. Choice D confuses one lost ability with ancestry.
Question 15 of 20 · Short Answer
Two invented 16-base segments are TTAGCCGATACGGTCA and TTAGCTGATACGATCA. How many bases differ, and what percent are identical?
They differ at position 6 (C and T) and position 13 (G and A): 2 differences. Identical bases = 14, and 14 ÷ 16 = 87.5%.
Question 16 of 20 · Short Answer
A horse's foreleg ends in one large toe, while a human arm ends in a hand with five fingers. Yet both contain a humerus, a radius and an ulna. Explain why this is evidence of common ancestry even though the limbs look and work very differently.
The shared bones in the same arrangement are homologous: both species inherited the forelimb plan from a common mammal ancestor, and the limb was modified for running in horses and for grasping in humans. If each limb had been built independently for its job, there would be no reason for the same set of bones to appear in both.
Question 17 of 20 · Short Answer
During the second month of development, a human embryo has a tail with several vertebrae. The tail then stops growing and is mostly reabsorbed, leaving the tailbone (coccyx). What does this observation suggest, and which other line of evidence could test the idea?
It suggests that humans descend from ancestors that had tails, and that the developmental program for a tail was inherited from them. It could be tested with anatomy (other apes also have a coccyx and no outer tail, while most monkeys have tails) or with DNA (comparing tail-development genes across primates).
Question 18 of 20 · Short Answer
Fossil horses from about 55 million years ago were dog-sized with four toes on each front foot; horses from about 35 million years ago had three toes; by about 5 million years ago one-toed horses were present. What does this sequence show about biological evolution, and why is it described as branching rather than a straight line?
It shows that the traits of horse populations changed over tens of millions of years, from several toes to one, which is evidence of biological evolution. It is branching because many horse species lived at the same time, and many lineages died out; the three fossils are samples from a bushy tree, not a single chain of parents and offspring.
Question 19 of 20 · Short Answer
Write a two-sentence museum sign that uses two different lines of evidence to show that bats and humans share a common ancestor.
Model answer: "The wing of a bat and the arm of a human contain the same bones, one upper arm bone, two forearm bones, wrist bones and finger bones, arranged the same way. Bat and human DNA are also far more similar to each other than either is to a bird's, so anatomy and DNA both show that bats and humans descend from a shared mammal ancestor." Full credit needs two lines of evidence, what each shows, and a clear claim.
Question 20 of 20 · Short Answer
An invented comparison of a 300-base segment gives these differences: A-B 45, A-C 12, B-C 44. Which two species share the more recent common ancestor? What must be assumed about the rate of DNA change for this conclusion to hold?
A and C, because they differ at only 12 bases (96% identical), compared with 45 and 44 for the pairs that include B. The conclusion assumes the segment changes at roughly similar rates in all three lineages; scientists check this by comparing many genes.
0 of 20 answered · 0 correct
06
Frequently Asked Questions
10 Questions
What does HS-LS4-1 mean?
HS-LS4-1 asks students to communicate how several kinds of evidence support common ancestry and biological evolution. Students work with DNA and protein comparisons, anatomical structures, embryo development and the fossil record, and they must explain the role of each line of evidence, not just list it. The code means High School, Life Science, core idea 4 (Biological Evolution: Unity and Diversity), performance expectation 1.
Is HS-LS4-1 taught in Biology?
Yes, it is usually taught in high school Biology, often at the start of the evolution unit. It builds on middle school work with fossils, anatomical similarities and embryos, and it comes before the standards on natural selection (HS-LS4-2 through HS-LS4-5).
What are the main lines of evidence for common ancestry?
The main lines are similarities in DNA and protein sequences, homologous and vestigial anatomical structures, the order in which structures appear in embryos, and the order of fossils in the rock record. The geographic distribution of related species is another line. Each is gathered with different methods, which is why their agreement is strong support.
What is the difference between homologous and analogous structures?
Homologous structures share an inherited underlying plan even if they do different jobs, like the bones in a human arm and a bat wing. Analogous structures do similar jobs but are built differently, like the wings of birds and insects. Only homologous structures are evidence of a close common ancestor; analogous ones show that similar ways of life can shape unrelated groups.
How does DNA show that species are related?
Species that share a more recent common ancestor have had less time for their DNA to change, so their sequences differ at fewer positions. Students count differences between aligned sequences, convert them to percent similarity, and use a table of differences to build a tree. Scientists compare many genes so that one fast-changing gene does not mislead them.
Does HS-LS4-1 have an assessment boundary?
No. HS-LS4-1 has a Clarification Statement but no official Assessment Boundary. The emphasis is conceptual: students should understand what each line of evidence contributes. Detailed methods such as building trees with computer algorithms or calculating mutation rates go beyond what the standard asks.
Did humans evolve from chimpanzees?
No. Humans and chimpanzees are both living species that share a common ancestor that lived millions of years ago. Their DNA is very similar because that shared ancestor is fairly recent, but neither species is the ancestor of the other. This is a good misconception to address directly in class.
What does "communicate scientific information" look like for this standard?
It means students present evidence clearly to an audience, in writing, aloud, or in a visual such as an infographic or a museum placard. A strong product names specific evidence, explains what it shows, and connects it to a claim. On this page, the placard, the evidence briefing and the letter to the editor are the communication tasks.
Why is embryo development evidence for evolution?
Because related species share inherited developmental programs, the same early structures appear in the same order in their embryos, such as a notochord, pharyngeal arches and limb buds in vertebrates. Embryos do not replay the adult forms of ancestors, and some 1800s embryo drawings exaggerated the similarities, so modern teaching uses photographs and the order of appearance instead.
How does HS-LS4-1 connect to other standards?
It extends MS-LS4-1, MS-LS4-2 and MS-LS4-3, where students first meet fossils, anatomical similarities and embryos. It pairs with HS-LS3-1, since DNA carries the inherited information that is compared, and it sets up HS-LS4-2 and HS-LS4-4, which explain how natural selection produces the change that the evidence documents.
07
Related Standards
5 standards
These standards connect to HS-LS4-1: prerequisites to review first, parallel standards at the same level, and next steps that build on it.
Before this lesson
MS-LS4-1Prerequisite
Analyze fossil record patterns of existence, diversity, extinction and change of life
NGSS is a registered trademark of WestEd. Neither WestEd nor the lead states and partners that developed the Next Generation Science Standards were involved in the production of this product, and do not endorse it.
